Evo 2 · 40B params · 9.3T nucleotides

The genomic design IDEthat thinks out loud.

Paste a sequence or describe a goal. Watch Evo 2 annotate, score, and fold it live - then click any base and feel the consequence in seconds.

Start designing Paste a sequence

chr17 · 43,044,295likelihood heatmap

ATGGCTAGCTAGGCATTACGGCATGCATTAGCGGCTATTACGCATGGCTAAGCTTGCAT

How it works

An editor, a compiler, and a lab notebook - for DNA.

01 / Generate

Design in plain English

Describe the element you want. Evo 2 streams candidate sequences base-by-base over a live socket - no spinners, no black box.

02 / Score

Four composition and motif signals

Composition and motif scores for function, tissue motifs, panel off-target overlap, and novelty, clearly marked as ranking heuristics, not clinical predictions.

03 / Fold

Sequence to structure

Top candidates fold through live ESMFold into 3D protein structures, coloured by per-residue confidence, rendered right in the browser.

04 / Edit

Click a base, feel the delta

Type directly into the sequence. Single-base edits re-score in under two seconds; natural-language follow-ups rerun only the stages that changed.

The bottleneck

From weeks in a wet lab
to minutes in a tab.

The interface layer genomic design has been missing.

Evo 2 can generate DNA (NIM), ESMFold folds coding ORFs when live, NCBI/ClinVar supply context cards, and Helio runs real tools. The 4D scores are composition and motif signals.

Open Proteus IDE